© 2000 by Oxford University Press
Journal of the National Cancer Institute, Vol. 92, No. 6, 464-474,
March 15, 2000
© 2000 Oxford University Press
Population-Based Study of Human Papillomavirus Infection and Cervical Neoplasia in Rural Costa Rica
Affiliations of authors: R. Herrero (formerly at the Ministry of Health, San Jose, Costa Rica), M. Plummer, International Agency for Research on Cancer, Lyon, France; A. Hildesheim, S. Wacholder, M. Schiffman, Epidemiology and Biostatistics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, Bethesda, MD; C. Bratti, J. Morales, I. Balmaceda, M. Alfaro, Caja Costarricense de Seguro Social, San Jose, Costa Rica; M. E. Sherman, Epidemiology and Biostatistics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, and Department of Pathology and Gynecology and Obstetrics, The Johns Hopkins Medical Institutions, Baltimore, MD; M. Hutchinson, Women and Infants' Hospital, Brown University, Providence, RI; M. D. Greenberg, Omnia Corporation, Philadelphia, PA; R. D. Burk, Departments of Pediatrics, Microbiology and Immunology and Epidemiology and Social Medicine, Albert Einstein College of Medicine, Bronx, NY.
Correspondence to present address: Rolando Herrero, M.D., Ph.D., Proyecto Epidemiologico Guanacaste, P.O. Box 301-6151, San Jose, Costa Rica (e-mail: rherrero{at}amnet.co.cr).
| ABSTRACT |
|---|
|
|
|---|
BACKGROUND: Human papillomavirus (HPV) is the main cause of cervical neoplasia. Because few population-based studies have investigated the prevalence of type-specific infection in relation to cervical disease, we studied a high-risk population, estimating the prevalence of HPV infection and the risk associated with various HPV types. METHODS: We screened 9175 women in Guanacaste, Costa Rica, to obtain a referent standard final diagnosis, and tested 3024 women for more than 40 types of HPV with a polymerase chain reaction-based system. RESULTS: Among women with normal cytology, HPV infections peaked first in women younger than 25 years, and they peaked again at age 55 years or older with predominantly non-cancer-associated types of HPV and uncharacterized HPV types. Low-grade squamous intraepithelial lesions (LSILs) (n = 189) decreased consistently with age. The prevalence of high-grade squamous intraepithelial lesions (HSILs) (n = 128) peaked first around age 30 years and again at age 65 years or older. Seventy-three percent of LSILs were HPV positive, with HPV16 being the predominant type (16% of positive subjects). HPV was found in 89% of HSILs and 88% of cancers, with HPV16 being strongly predominant (51% and 53% of positive subjects). Virtually all HSILs and cancers had cancer-associated HPV types, with high odds ratios (ORs) and attributable fractions around 80%. Risk for HPV16 was particularly high (OR for HSILs = 320, 95% confidence interval [CI] = 97-1000; OR for cancer = 710, 95% CI = 110-4500). CONCLUSIONS: We confirm the early decline of HPV infection with age but note increased prevalence after menopause, which could be related to a second peak of HSILs, an observation that warrants further investigation. At least 80% of HPVs involved in cervical carcinogenesis in this population have been characterized. Polyvalent vaccines including the main cancer-associated HPV types may be able to prevent most cases of cervical disease in this region.
| INTRODUCTION |
|---|
|
|
|---|
Worldwide, about 200 000 deaths each year are caused by cervical cancer (1), and its prevention with cytologic screening programs requires enormous investments from health agencies. Certain types of human papillomavirus (HPV) are now recognized as the main cause of cervical cancer and its precursor lesions (2). The development of a prophylactic vaccine against these infectious agents now appears to be the most promising way of controlling cervical neoplasia.
HPV infection of the uterine cervix is one of the most common sexually transmitted diseases (3), which is usually acquired around the time sexual activity begins. Consequently, cervical infections are frequently detectable among young women (4,5). Although the majority of infections are detectable only with molecular techniques, the most common cytopathologic manifestations of cervical HPV infection are low-grade squamous intraepithelial lesions (LSILs), i.e., cervical intraepithelial neoplasia 1, including koilocytotic atypia and flat condyloma. These lesions occur in the transformation zone of the cervix. They are characterized typically by cytoplasmic cavitation and nuclear atypia, cytopathic effects of a productive HPV infection (6).
Generally, pathologic changes and the molecular evidence of infection (HPV DNA detection) regress spontaneously with time (6,7), as do cutaneous warts caused by HPV types that infect nongenital skin. For yet unknown reasons, when the infection does not resolve, high-grade squamous intraepithelial lesions (HSILs) can develop and progress to cancer over a period of several years. HSILs are characterized by more severe nuclear alterations, less evidence of productive HPV infection, a more restricted set of HPV types, and a higher tendency to progress to invasive carcinoma. It has been proposed that infections with certain HPV types (mainly, types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, and 68) are most likely to progress to cancer. These types have thus been designated "cancer-associated," but other aspects of the virus and host are likely to be involved in progression.
A working model describing the natural history of HPV infection has been assembled from multiple sources. However, to our knowledge, no group has investigated the whole spectrum of disease (HPV infection, LSILs, HSILs, and cancer) in a truly unselected random sample of a large defined population.
Furthermore, the distribution of HPV types in defined populations and the association of each HPV type with the severity of cervical disease need to be described in detail.
We report the results of a population-based screening of 9175 randomly chosen women in a rural province of Costa Rica. The screening included an intensive diagnostic work-up and testing a large sample of subjects for more than 40 types of HPV. The population-based nature of this study provides previously unavailable unbiased estimates of the prevalence of the full spectrum of HPV infections. The cross-sectional information derived from this analysis, in conjunction with the expected prospective data from an ongoing follow-up of this cohort, should aid in the design of phase III trials of HPV vaccines. These trials will probably be conducted in high-risk populations, such as the one in Guanacaste.
| SUBJECTS AND METHODS |
|---|
|
|
|---|
Study Population
This study was conducted in Guanacaste, a rural province of Costa Rica with a population of about 240 000 inhabitants, who have a high incidence of invasive cervical cancer (average annual incidence rate in past 10 years = 33 cases per 100 000 women, adjusted for the age distribution of the world population).
Detailed methodologic aspects of this investigation have been reported (8). A random sample of 16.4% (178 of 1083) of the smallest geographic
divisions established in Guanacaste by the Costa Rican census bureau (i.e., censal segments) was
selected to obtain approximately 10 000 women for a cohort study of the natural history
of HPV
infection and cervical neoplasia. Careful house-to-house enumeration of all adult women
(
18 years old) residing in those segments was conducted over a 6-week period by outreach
workers of the Costa Rican Ministry of Health, under our supervision. The census data for the
segments selected for the study were compared (in combination) with data from the national
1984 census (the last available census) with respect to age group, province of birth, nationality,
social security affiliation, province of residence 5 years earlier, educational level, marital status,
labor force participation, and children currently alive. Data from the combined segments and the
whole province appeared to be similar for all variables examined. From June 22, 1993, through
December 12, 1994, the 11 742 women identified in the 178 censal segments above were invited
by mail or personal visits to participate in the study. They were given appointments at the nearest
government clinic to participate in a research project that included cervical cancer screening. At
the clinic, women with mental or language problems were identified and excluded, and eligible
women were identified and given detailed explanations of the study. Women who agreed to
participate then signed informed consent forms approved by Institutional Review Boards of
Costa Rica and the U.S. National Cancer Institute.
Data and Specimen Collection
Female interviewers conducted private, standardized interviews in which data were collected on demographic factors, medical histories, and behaviors (sexual, reproductive, and smoking) related to the risk of cervical cancer. Women who reported previous sexual activity were given a pelvic examination by female nurses trained by expert clinical collaborators. Any woman with obvious lesions was referred to the study gynecologist (J. Morales) for immediate gynecologic evaluation and treatment. During the pelvic examination, the nurse collected exfoliated cervical cells with a Cervex brush (Unimar, Wilton, CT) by placing the tip of the brush in the endocervix and rotating it five times in one direction (1800 °). The cells were used for the preparation of a conventional Pap smear, which was fixed immediately (PapPerfect; Medscand, Hollywood, FL) and later stained and interpreted by our collaborating cytopathologists in Costa Rica (M. Alfaro and S. Mekbel, Caja Costarricense de Seguro Social, San Jose, Costa Rica). The brush was placed in a methanol-based medium (PreservCyt; CYTYC, Boxborough, MA) for the preparation and interpretation of thin-layer slides at Tufts University, Boston, MA (M. Hutchinson, formerly at Tufts University). After the Pap examination, additional cells were obtained for HPV testing with a Dacron swab that was rotated 180 ° inside the endocervical canal and then used to collect cells from the entire circumference of the ectocervix. The cells were preserved in specimen transport medium (STM; Digene, Silver Spring, MD) and frozen at -30 °C in Guanacaste and later at -70 °C, after transport, until testing for HPV. After cells were collected as described above, the cervix was rinsed twice with 5% acetic acid, and a cervigram examination was performed. A cervigram consists of two photographs of the cervix, which were later developed at National Testing Laboratories (Fenton, MO) and interpreted by expert colposcopists (M. D. Greenberg and M. Campion, formerly at the Graduate Hospital, Philadelphia, PA).
Diagnostic Procedures
Cytologic specimens (conventional smears and thin-layer slides) were classified with the modified Bethesda System (9,10) into normal, ASCUS (atypical squamous cells of unknown significance), LSIL (cervical intraepithelial neoplasia 1, including koilocytotic atypia), HSIL (cervical intraepithelial neoplasia 2 and 3), and cancer. After Costa Rican cytopathologists had read the conventional Pap smears, the smears were analyzed with the PapNet method, which makes digital tapes containing 128 video images of the most important computer-selected areas of the smear.
In this study, these images were then reviewed on a computer screen by a senior cytotechnologist (D. Kelly) at The Johns Hopkins University, Baltimore, MD. Any smears with cells suspected of being neoplastic were referred to the expert study pathologist (M. E. Sherman) for final diagnosis.
All women with an abnormal cytologic test (ASCUS or more severe) were referred to the study colposcopist, who performed a biopsy of visible lesions. The median period between enrollment visit and colposcopy visit was 13 weeks (range = 4-65 weeks). Biopsy specimens were analyzed by local pathologists and reviewed by the study pathologist (M. E. Sherman). Cervigrams were classified as negative, atypical, or positive; women with positive results were referred for colposcopic evaluation. In addition, a random sample of one in 50 women in the study was referred for colposcopy as a control group, irrespective of their screening diagnosis. All confirmed or highly suspicious high-grade or invasive lesions were treated at the collaborating hospitals with loop excision, surgical conization, hysterectomy, or radiotherapy, according to local protocols.
The final diagnoses of most cases of cervical neoplasia were readily evident from algorithms combining the various cytologic and histologic diagnoses (see below). When a diagnosis was unclear, the study pathologist evaluated all available cytologic and histologic specimens to determine the final diagnosis. Diagnostic categories used were as follows: 1) normal = women with normal cytologic screening results, including those with abnormal cervigrams who did not have abnormalities in other tests (in the absence of cytologic abnormalities, a positive cervigram was not associated with HPV detection); 2) ASCUS = women with an ASCUS cytologic diagnosis with no substantial disease confirmed by colposcopy and/or biopsy (normal colposcopy not requiring biopsy or abnormal colposcopy but a non-SIL biopsy); 3) conventional LSIL = women with only conventional cytologic evidence of LSILs (the most severe of conventional or PapNet diagnoses) that was not histologically confirmed (normal colposcopy not requiring biopsy or abnormal colposcopy but a non-SIL biopsy); 4) thin-layer LSIL = women with evidence of LSILs only in the thin-layer smear; 5) "confirmed" LSIL = women with histologically confirmed LSILs or with at least two of the three criteria of conventional LSIL, thin-layer LSIL, or a positive cervigram; 6) HSIL = women with histologically or unequivocal cytologically confirmed HSILs after review; or 7) cancer = women with histologic or unequivocal clinical evidence of invasive cervical cancer. Histologic confirmation was obtained for all cancers detected in the population-based sample, 93.0% of HSILs, and 39.2% of confirmed LSILs.
To supplement the anticipated small number of women with invasive cancers, a rapid detection system was established to identify all residents of Guanacaste who were diagnosed with invasive cervical cancer during the enrollment period (supplemental cancers). A network was set up for the rapid notification of study staff when such a patient was diagnosed at one of the three main cancer referral hospitals in Costa Rica (San Juan de Dios, Calderon Guardia, and Mexico), diagnosed at the regional hospitals in Guanacaste, or reported to the National Tumor Registry. Patients considered eligible for the study completed the study questionnaire, and specimens were collected as described above. Twenty-eight women were eligible as supplemental patients with cancer, and valid HPV results were available from 22 (79%) of them. Because these supplemental patients originated from the same study base, they were added to the 12 patients with cervical cancer identified among women in the study sample.
HPV Testing
HPV testing by polymerase chain reaction (PCR) was performed on exfoliated cervical cells from 3024 women, and valid results were available from 2974 after excluding those with inadequate specimens (see below). Subjects selected for HPV testing included all women with abnormal cervical diagnoses (1364 women). The following women were also selected for HPV testing: all women with positive cervigrams in the absence of cytologic abnormalities (n = 311), all women who tested positive for HPV DNA with a less sensitive screening test [n = 301; a hybrid capture tube test (11)], all women with a higher than average number of sexual partners (n = 333), and women in a random sample selected as a control group from the entire cohort (n = 340; see below) regardless of diagnosis and who may belong to overlapping groups mentioned above. Finally, an additional random sample of the women not included in the above groups was also selected for HPV testing, for a total of 1610 normal women.
We tested these groups for HPV to obtain baseline HPV data on subjects with prevalent disease at enrollment and on their corresponding control subjects and to obtain data on women with the highest potential of developing cervical neoplasia during the follow-up period of the study.
The prevalence of HPV infection in the general population was estimated from the results of the various population samples by weighting according to sampling fractions to avoid bias (see below).
Cervical cells were processed in a BioSafety Cabinet (SterilGARD Hood, Baker Inc., Sanford, ME) in a laboratory physically separated from where the PCR amplification was performed as described (5).
Aliquots of 400 µL were taken from the residual specimens previously tested by the hybrid capture tube test. Cells were removed with a disposable, sterile transfer pipette, placed in 100 µL of K buffer (12) containing proteinase K at 400 mg/mL, and incubated at 55 °C for 2 hours and at 95 °C for 10 minutes (7,12). Ten microliters of this material was then amplified by PCR with the MY09/MY11 L1 consensus primers including HMB01 (7), which amplifies a 450-base-pair HPV DNA fragment, and a control primer set, PC04/GH20 (12), which simultaneously amplifies a 268-base-pair cellular ß-globin DNA fragment and serves as an internal control. Ten microliters of PCR products or the entire reaction mixture was analyzed by gel electrophoresis in 3% NuSieve-0.5% SeaKem agarose (FMC BioProducts, Rockland, ME) and transferred to nylon filters. The filters were hybridized overnight with radiolabeled generic probes for HPV and an oligonucleotide for ß-globin as described (12,13). The filters were washed in 2x standard saline citrate (SSC; 1x SSC = 0.15 M sodium chloride and 0.015 M sodium citrate [pH 7])/0.1% sodium dodecyl sulfate at 55 °C and exposed to x-ray film.
Samples that hybridized the ß-globin probe but not the generic probe were considered HPV negative. Subjects whose samples were negative for the ß-globin probe and negative for the generic probe (n = 50; 1.7% of those tested) were excluded from the analysis. Samples that were ß-globin negative but PCR positive were considered HPV positive. PCR products that hybridized to the HPV generic probe were tested with more than 40 specific types of HPV DNA. Seven-microliter aliquots of PCR products were denatured in 0.4 M NaOH-25 mM EDTA and applied to 10 replicate filters with a 96-well dot-blot apparatus (Bio-Rad Laboratories, Hercules, CA). Filters were individually hybridized, as described (7,12,14), to biotinylated, type-specific oligonucleotide probes for the following types of HPV: 2, 6, 11, 13, 16, 18, 26, 31, 32, 33, 34, 35, 39, 40, 42, 43, 45, 51, 52, 53, 54, 55, 56, 57, 58, 59, 61 (AE4), 62, 64, 66, 67, 68, 69, 70, 72, 73 (PAP238A), AE2, W13B, 83 (PAP291), and PAP155 [probes referenced or described in (15)], AE5 (CTGCAACTACTAATCCAGTTCC), AE6 (CCACAGAATACAGTTCTACACGCT), AE7 (AGCTACATCTGCTGCTGCA), and 71 (AE8) (CTGTGCTACCAAAACTGTTGAG). Samples that gave a positive result with the generic probe mixtures but a negative result with all type-specific probes were considered to have "uncharacterized" HPV types. In this analysis, the group of a priori cancer-associated HPV types includes 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, and 68. These HPVs are also the 13 most common types in the International Biological Study on Cervical Cancer (16). The group of "non-cancer-associated" HPV types includes all other HPV types tested. Some of these are recognized non-cancer-associated types (e.g., HPV2, HPV6, HPV11, HPV32, HPV40, HPV42, and HPV57), and others are HPV types with undetermined oncogenic potential (e.g., HPV53, HPV54, HPV61, HPV62, HPV64, HPV67, HPV69, HPV70, HPV72, HPV73, etc.). The strength of the hybridization signal was determined from the ethidium gel and autoradiogram, by taking into account the strength of the hybridization signal and the thickness of the band in the gel. Signal strength data were independently reviewed by two investigators, and discordant results were resolved by consensus.
Statistical Analysis
We used odds ratios (ORs) with 95% confidence intervals (CIs) to estimate relative
risk and multiple logistic regression to adjust for potential confounding variables. In the logistic
regression, we adjusted for age by using six age groups (<25 years old, 25-34 years old, 35-44
years old, 45-54 years old, 55-64 years old, and
65 years old).
A random sample of 389 women was selected as a subcohort, without considering their screening results, to check the sensitivity of our screening protocol and to provide a random control group. Of these 389 women, 31 were excluded because of reported hysterectomies and 18 were excluded because their cervical specimens were ß-globin negative, leaving a control group of 340 women.
In the calculation of ORs, subjects in the control group with the diagnosis under study were
included as case subjects, but subjects with more severe diagnoses were excluded from the
analysis. For example, when ORs were calculated for confirmed LSILs, control subjects with
confirmed LSILs (n = 8) were considered case subjects, control subjects with HSILs (n
= 2) were excluded, and control subjects with normal (n = 305), ASCUS (n
= 18), thin-layer LSIL (n = 4), or conventional LSIL (n = 3) diagnoses
were retained as control subjects. Risk associated with a single infection by individual HPV type
was estimated by excluding women with multiple infections from the analysis (11 patients with
cancer, 38 patients with HSILs, 59 patients with confirmed LSILs, and 20 control subjects). For
the calculation of attributable fraction or proportion of disease attributable to individual or
grouped HPV types, the following formula was used: attributable fraction = percent case
subjects who are HPV positive x [1 - (1/OR)] (17,18). ORs for the estimate of attributable fractions (see Table 4
) were
calculated by including each subject hierarchically in only one category of HPV type (HPV16;
HPV18, HPV31, or HPV45; other cancer-associated, non-cancer-associated, and uncharacterized
HPV types) and comparing them with HPV-negative subjects. Adjustment for other cervical
cancer risk factors (education, age at first intercourse, number of sexual partners, number of
pregnancies, duration of oral contraceptive use, and ever smoking) did not meaningfully modify
the risk estimates. Therefore, for simplicity, only age-adjusted results are presented. Because
HPV testing results were available from all subjects with abnormal diagnoses but were available
from only a fraction of those with normal results, bias was prevented by weighting with a
Horvitz-Thompson-type estimating function (19). This function inversely
weights the contribution of each subject by her probability of selection. This analysis was carried
out by multiplying the percentage of women positive for HPV DNA in each subgroup of normal
women tested (e.g., those selected on the basis of a known above-average number of sexual
partners) by the prevalence of HPV in each individual subgroup, to arrive at the estimate for the
normal category. This estimate was then added to the other categories to obtain the total. CIs for
the prevalence estimates were calculated by the information sandwich technique (20,21) under the assumption that subjects were sampled from an infinite population.
All P values are from two-sided tests.
Participation Rates
The original sample from the census of selected segments included 11 742 women, of whom 10 738 were eligible for the study and 10 049 were interviewed (94%). The majority of nonparticipants refused or did not show up for their appointments after multiple invitations.
Noneligible women included pregnant women who could not schedule a repeat visit by 3 months postpartum (2.6%), women who had moved out of Guanacaste (4.4%), and women who were physically ill (0.5%), mentally ill (0.7%), or dead (0.4%).
After exclusion of women without previous sexual experience, 9466 women of those interviewed were considered eligible for a pelvic examination, which was performed on 9175 women (97%), for an overall participation rate of 91%. The main reason for not performing a pelvic examination was refusal or physical problems associated with old age (41% of subjects not examined were older than 65 years), although more than 80% of older women received a pelvic examination. Satisfactory results of a conventional Pap test were available from 9093 women (99% of those with pelvic examinations), thin-layer diagnoses were available from 8694 (95%), PapNet results were available from 7375 (80%), and cervigram results were available from 9062 (99%). The reduced number of PapNet results occurred because of difficulties in shipping and processing specimens (22). Detailed analyses of the performance of all methods used are reported elsewhere (22-24).
For this analysis, women who reported hysterectomy (n = 621) were excluded,
leaving 8582 women in the analytic dataset (8554 women from the population sample and 28
supplemental patients with invasive cancers). HPV results were available from more than
91% of subjects in each category of abnormal diagnoses (Table 1
),
except for women with
invasive cancers, where HPV results were available from 85% of the patients. HPV results
also were obtained from 23% of subjects with normal cytologic diagnoses (n =
1610) selected as described above.
|
| RESULTS |
|---|
|
|
|---|
Characteristics of the Population
The median age of women included in this analysis was 37 years (range = 18-94 years). The median age at first sexual intercourse was 18 years, and more than half of the women reported only one lifetime sexual partner. A substantial proportion of the women reported multiple pregnancies (median = 4). Only 11% of the women in the sample reported ever having smoked. Most women reported having used oral contraceptives (63%) and having had a Pap test (87%). Characteristics of the control group of 340 randomly selected women tested by PCR were compared with characteristics of all 8554 women from the population sample, and no statistically significant difference was noted for any variable discussed above (data not shown).
Prevalence of HPV Infection and Cervical Neoplasia
The estimated overall prevalence of HPV in this population was 16%
(95% CI = 15-18). Table 1
presents the
distribution of subjects, the overall prevalence of each diagnostic
category, the number of subjects tested for HPV, the overall prevalence
of HPV, and the prevalence of cancer-associated (HPV types 16, 18, 31,
33, 35, 39, 45, 51, 52, 56, 58, 59, and 68), non-cancer-associated (all
other HPV types investigated), and uncharacterized HPV types.
Age-adjusted ORs and 95% CIs associated with having any type of HPV
are presented also. Prevalence of detection of any type of HPV was 73%
in LSILs, 89% in HSILs, and 88% in cancers. More severe disease was
associated with higher prevalence of HPV DNA, higher prevalence of
cancer-associated HPV types, and higher ORs in association with HPV
detection. Women with final diagnoses of normal, ASCUS, conventional
LSILs, and thin-layer LSILs were more likely to have
non-cancer-associated or uncharacterized HPV types than
cancer-associated HPV types; the opposite was true for confirmed LSILs,
HSILs, and cancer.
Fig. 1,
A, shows the estimated age-specific prevalence (and
95% CIs) of any type of HPV infection among women with normal or ASCUS diagnoses.
Prevalence was highest (around 20%) for women under age 25 years, decreased to about
5% for women 35-54 years old, and then increased to almost 20% for women 65
years old or older. Fig. 1,
B, presents the estimated prevalence for
cancer-associated,
non-cancer-associated, and uncharacterized types of HPV. The last types were included as a
separate group because of their strong association with risk of HSILs and cancer (see below and see Table 4
). Among women younger than 25 years,
cancer-associated types
predominated slightly, followed by non-cancer-associated types. Among women 55 years old or
older, the pattern seemed to be reversed, with non-cancer-associated and uncharacterized types
predominating. This pattern was driven mainly by the HPV type distribution among women with
normal diagnoses because women with ASCUS diagnoses had a predominance of
cancer-associated types in both age groups. Among women with ASCUS, the prevalence of
cancer-associated and non-cancer-associated types increased after age 55 years, with
cancer-associated types predominating. Estimates for that age group, however, were based on a
smaller sample (n = 72 older women with ASCUS; data not shown).
|
The median age of patients with confirmed LSILs was 29 years. The prevalence of this diagnosis was highest in women younger than 25 years (Fig. 2
|
The median age of patients with HSILs was 34 years. An initial peak of 2.0% at around age 30 years was observed, and a second peak of a similar magnitude was evident among women 65 years old or older. Although the number of older subjects with HSILs was small (17 women aged 65 years or older), the difference between the prevalence of HSILs in women 55-64 years old and women 65 years old or older was marginally statistically significant (two-sided Fisher's exact test, P = .05). In this context, women in the study population 55 years old or older were less likely to have been screened previously than younger women (75% versus 90%, P<.001).
The median age of the 12 women with screen-detected cancers was 39.5 years, but their age distribution was difficult to interpret because of their small numbers in our study. The 28 women with supplemental cases of cancer had a median age of 58 years (data not shown). As expected, 75% of the screen-detected cancers were diagnosed at early stages (International Federation of Gynecology and Obstetrics stages I and II) compared with only 19% of supplemental cancers.
Prevalence of HPV Types in Each Diagnostic Category
The prevalence of specific HPV types was calculated for the 305 control women with normal cytologic findings selected randomly from the cohort (excluding final diagnoses of ASCUS or more severe).
Twenty-six types of HPV were detected among women with normal diagnoses (Table 2
), and HPV16 and HPV18 were uncommon (each at 1.0%;
9.1% of positive subjects), as were the condyloma-associated types HPV6 and HPV11.
Multiple infections were present in 4.3% of normal women, corresponding to 39%
of the infections.
|
In confirmed LSILs, 32 HPV types were detected. The most common was HPV16 (prevalence = 12%; 16% of positive subjects), followed by HPV types 51, 56, 58, 52, 31, 70, 39, 53, and 6. Uncharacterized types were common (prevalence = 5.0%; 6.8% of positive subjects). Almost all other types of HPV investigated were found in at least one LSIL. Multiple infections were detected in 33% of LSILs, corresponding to 45% of positive subjects. The proportion of HPV-positive subjects with cancer-associated HPV types was similar among women with LSIL in different age groups (data not shown).
Twenty-eight HPV types were detected in HSILs. The most common type by far was HPV16, found in 45% of HSILs (51% of positive subjects), followed by HPV58, detected in 10% of HSILs. Most HSILs had at least one previously identified cancer-associated type. However, in one HSIL, HPV72 was detected alone; in another HSIL, HPV83 (pap291) was detected alone. In addition, HPV70, HPV53, HPV67, and AE5 (the last two in the same subject) were detected in some HSILs without cancer-associated types. Uncharacterized types were present in 4.0%, with multiple infections in 30% (34% of positive subjects).
In the 34 cancers, 18 HPV types were detected. All cancers had previously identified cancer-associated types, except for one in which HPV66 was detected.
As observed for HSILs, HPV16 was the most common type (47%; 53% of positive subjects), followed by HPV18 (15%; 17% of positive subjects) and HPV58 (12%; 14% of positive subjects). Multiple infections were detected in 32% of the cancers (36% of positive subjects). Among women with HPV-positive HSILs and cancers, the proportions with cancer-associated types were similar in different age groups, except for women 65 years old or older, who had a somewhat higher prevalence of non-cancer-associated HPV types detected as the only infection (22% versus <8% in all other age groups combined).
Table 3
shows the HPV types detected in HSILs and cancers among
women with multiple infections and indicates which type(s) had the strongest signal. Each cancer
tested had at least one high-risk HPV type; of the 11 cancers with multiple HPV types, seven had
at least two high-risk types. Similarly, of 38 HSILs with multiple types, 34 (89%) had
recognized cancer-associated HPV types. For cancers and HSILs, cancer-associated HPV types
almost invariably had the strongest PCR signal.
|
|
ORs and Attributable Fractions
Table 4
presents the prevalences and ORs for HPV
types associated with various diagnoses. Subjects were considered
hierarchically positive in only one of the groups, and HPV-negative
subjects were the referent category.
Cancer-associated HPV types were present in more than 50% of confirmed LSILs and were associated with double-digit ORs. Non-cancer-associated HPV types were detected in about 15% of confirmed LSILs and were associated with lower ORs. The attributable fraction associated with HPV of any type was 68%. HPV16 was detected in almost 50% of the HSILs and was associated with a 320-fold increase in risk (95% CI = 97-1000). The attributable fraction for cancer-associated types of HPV was almost 80%; for any HPV, the attributable fraction reached 87%. A similar pattern was observed for cancers, with an attributable fraction for cancer-associated HPVs close to 80%, the presence of HPV16 in about 50% of the cancers, and an even higher OR for HPV16 of 710 (95% CI = 110-4500).
ORs associated with single HPV infections were calculated after excluding multiple infections. With the exception of a few HPV types, the number of lesions with single HPV types was relatively small and produced increased, but statistically nonsignificant, risk estimates, particularly for cancer-associated types (data not shown). For LSILs, statistically significant ORs were observed for HPV types 16, 39, 51, 52, and 58, with magnitudes between OR = 8.9 (95% CI = 1.6-49) for HPV58 and OR = 41 (95% CI = 4.9-340) for HPV51.
For HSILs, statistically significant associations with risk were detected for HPV types 16, 58, 51, and 52, with magnitudes between OR = 20 (95% CI = 3.8-100) for HPV51 and OR = 1400 (95% CI = 120-16 000) for HPV16. For the 34 women with cancer, statistically significant risk estimates were observed for HPV16 (OR = 470; 95% CI = 68-3300) and HPV18 (OR = 120; 95% CI = 6.7-2200).
ORs were calculated by comparing women with multiple HPV type infections and women with single infections. No statistically significant increases in risk were observed for any of the diagnoses (data not shown).
To investigate the effect of HPV16 on risk of HSIL or cancer combined (HSIL/cancer) in the
presence of other types of HPV, we estimated ORs for HSIL/cancer associated with HPV16
infections alone, associated with infections of multiple HPV types not including HPV16, or
associated with infections of multiple HPV types including HPV16 (Table 5)
. A multiple infection not including HPV16 was associated with an OR of 29
(95% CI = 13-66), and an infection with HPV16 alone was associated with an OR
of 450 (95% CI = 100-2000). However, a multiple infection including HPV16 was
not associated with a higher risk than the other categories (OR = 190; 95% CI
= 39-920).
|
Fig. 3
|
| DISCUSSION |
|---|
|
|
|---|
To our knowledge, this is the first population-based study to investigate the prevalence of HPV types in all grades of cervical neoplasia observed in a large sample of a high-risk population. We used multiple screening techniques and carried out extensive diagnostic work-ups to ensure completeness of case identification and classification. More than 90% participation in all components of the study was attained, assuring the representativeness of our study population and allowing population-wide estimates by sampling. The use of a randomly selected control group also permitted unbiased assessment of ORs and attributable fractions for specific HPV types. Women in Guanacaste were characterized by frequent monogamy (>50%), high parity, limited education, and a high frequency of previous screening. Notably, the persistently high incidence of cervical cancer in Guanacaste indicates the limited effectiveness of previous screening.
The estimated overall prevalence of HPV infection was 16% in the entire population. Among women with normal cervical diagnoses, the estimate was 11%, corresponding to the point prevalence of current HPV DNA detection. The cumulative incidence of infection is certainly higher and will be examined with HPV serologic markers and follow-up data from the same population.
We created diagnostic categories to indicate the severity of cervical disease, without regard to HPV infection. We observed, however, that increasingly severe diagnostic categories were strongly associated with increasing overall detection of HPV in the lesion, increasing prevalence of cancer-associated HPV types, and increasing ORs, when compared with the control group. Theoretically, all LSILs are the result of a productive HPV infection; thus, HPV DNA should always be detectable. However, we observed that HPV DNA was not detected in almost 30% of LSILs, which indicates some misclassification of disease or HPV status. Because the main goal of our study was to detect HSILs with high sensitivity by the use of multiple screening techniques, we referred more than 20% of subjects to colposcopy and thus complicated the final case definition.
HPV detection was strongly associated with age for women with normal or ASCUS diagnoses, being high in the youngest women and declining rapidly to a low in women around 35 years, as described by other investigators (4,5). However, in this population, the prevalence of HPV types, particularly non-cancer-associated HPV types, increased again among women 55 years old or older. For women with ASCUS diagnosis, cancer-associated types predominated at all ages, but the prevalence of cancer-associated and non-cancer-associated HPV types also increased after age 55 years. We have described (8) a similar but less marked pattern in the same population by use of the hybrid capture method. The second peak of prevalence is intriguing and has not been consistently noted by others, in part because some studies have not included enough older women. It is interesting that Muñoz et al. (25) have reported similar data for age and the detection of HPV DNA among control women in their studies in Spain and Colombia, although the predominant HPV types in those women were cancer associated and uncharacterized (26,27).
One possible explanation for this second peak would be a cohort effect, with older women having been exposed more intensely to HPV. Alternatively, the second peak could indicate reactivation of a latent HPV infection, a possibility that has been proposed for women also infected with human immunodeficiency virus (28).
Another possibility could be that the detection of HPV increases as atrophic changes occur in the postmenopausal cervix. Currently, we cannot explain the marked increase in HPV detection among older women, and more investigation in different populations, including risk factors for infection by different types (29,30,31), and in different age groups is needed. Such studies should incorporate markers of immune suppression and HPV type-selective tests for viral latency when available.
The 11% overall estimated prevalence of HPV infection in women with normal diagnoses in our study population was somewhat lower than values observed in other case-control studies in high-risk countries, particularly among middle-aged women (25,32). This difference could be explained by our strict criteria for definition of normal diagnoses, differences in the population selected, or limited sensitivity of our PCR.
The prevalence of LSILs was highest among the youngest women, with a median age of 29 years, and coincided with the first peak of HPV infection among normal women. However, we did not observe a second peak of LSILs in the older women. This could indicate that older women are less prone to develop overt cervical intraepithelial neoplasia because of cervical atrophy or mature metaplastic epithelium in the transformation zone.
The observation that the prevalence of HSILs peaked in women 25-34 years old is consistent with previous findings (33) and the hypothesis of a disease continuum with progression from HPV infection to HSIL to cancer. In fact, we could roughly divide the HSILs into the equivalent of cervical intraepithelial neoplasia 2 and 3, with corresponding median ages of 33 and 37 years, respectively, which would corroborate the hypothetical transition time of more than 5 years from HPV infection (including LSILs) to HSILs. In this population, a second peak of HSILs is observed in older women, which could be partially explained by a cohort effect in screening behavior. Fewer women older than 55 years had a history of being screened, but this explanation would imply the existence of long-term lesions that do not progress to cancer. Alternatively, this could reflect the second peak of HPV DNA, which might result from reactivation of latent HPVs, particularly some types of yet unknown carcinogenic potential.
The number of cancers detected in our study was too small to allow conclusions about prevalence in our sample. However, the median age of women with screen-detected cancers was 39 years, which is 5 years older than the median age of women with HSILs. It has been proposed that HSILs progress to subclinical cancer in 9-10 years and that subclinical invasive cancer progresses to symptomatic invasive cancer in 4-5 years (33). Our findings are consistent with the progression time from HSIL to subclinical cancer if only the early peak at age 30 years is considered. However, the median age of women with supplemental cases of cancer was 58 years, which, if compared with the mostly early-stage cancers detected in the sample, would indicate a very slow progression from subclinical to symptomatic cancer, although this difference could be explained by chance. These findings also probably indicate inadequate follow-up and treatment of dysplasia, despite a frequent history of screening among women in Guanacaste.
In normal women, we detected almost all HPV types for which we tested, and no type was clearly predominant. HPV16 was detectable in only about 1% of normal subjects. Because HPV16 is rare among normal women but common in women with HSILs and cancers, its predictive value may be even higher than suspected, particularly in this population. It could also partially reflect the fact that our definition of "normal" is stricter than definitions in other studies, given our highly sensitive screening.
In LSILs, almost all HPV types were detected, and HPV16 was the most common. Cancer-associated HPV types were present in more than 50% of the lesions (corresponding to 75% of the HPV-positive lesions). The LSILs harboring cancer-associated HPV types are probably the most likely to persist and progress (34), but the clinical value of cancer-associated HPV detection as a predictor of the behavior of LSILs has not been determined.
In addition to the cancer-associated HPV types, several other types of HPV were also frequently detected in LSILs, indicating that a subset of LSILs is caused by non-cancer-associated HPV types. Such HPV types theoretically would not have the potential to cause progressive disease despite being able to cause apparently similar cytologic abnormalities. Whether the LSILs produced by such HPVs have distinctive colposcopic or microscopic characteristics is unclear.
The majority of HSILs and cancers were associated with previously identified cancer-associated HPV types, particularly HPV16, which was detected in almost 50% of both types of lesions. This finding is consistent with previous reports (35-38). HPV58 was the second most common HPV type in HSILs and the third most common type in cancers in our population. This finding is in contrast with the findings of Bosch et al. (16), who found that HPV58 was not common among cancer patients from Central America or South America. However, two reports from China (39,40) indicate that HPV58 is common in patients with cancer in the Pacific region.
In our study, HPV18 was the second most common type in cancers but was not so in HSILs. These findings could indicate that an HPV18 infection could lead more rapidly to cancer than infection with other cancer-associated HPV types. In several studies (41-43), the survival of patients with cervical cancer was worse for women harboring HPV18, independent of the stage at diagnosis.
In HSILs, besides known cancer-associated types, HPV72 and HPV83 (pap291) were identified as the only HPV types present (each in only one patient). HPV70, HPV53, HPV67, and AE5 were detected in HSILs containing multiple types of HPV but no cancer-associated HPV types. HPV66 was detected alone in one cancer. Thus, HPV66, HPV70, HPV72, HPV53, HPV67, HPV83, and AE5 should be regarded as potentially cancer associated. HPV53 and HPV66 have previously been classified as cancer associated based on phylogenetic analysis (44), and HPV70 has been the only HPV type detected in some invasive carcinomas (45). Some of these findings could be explained by multiple infections in which cancer-associated HPVs have integrated in the host genome and abolished L1 expression (46) or by the inability of our PCR to detect certain cancer-associated HPV types.
Multiple HPV-type infections were found in many cervical neoplasias, including invasive carcinomas, but they were not associated with increased risk of disease above that associated with a single HPV-type infection. The proportion of multiple HPV infections that we detected was somewhat higher than that detected by Kalantari et al. (37) but was similar for all grades of cervical intraepithelial neoplasia. It is unknown whether these multiple infections are associated with coexisting cervical lesions of different grades, an issue that could be important in formulating a vaccine.
Bosch et al. (16) detected multiple infections in only a few patients, but that study used biopsy material where only the clonally expanded HPV type would be expected. We would expect to detect multiple infections in samples of exfoliated cells because these cells come from a wider area of the cervix and vagina. Similar to our findings, Ho et al. (38) did not find a substantially increased risk associated with multiple infections, supporting the view that cervical neoplasia is the result of clonal expansion of a cell infected with a single type of HPV. Additional support for the absence of an interaction between types is provided by our findings that the risk associated with HPV16 alone is similar to or higher than the risk associated with HPV16 in the presence of other HPV types. However, small numbers of HPV16-positive control subjects limited our ability to investigate this issue further. The complex interrelationship of multiple HPV types requires further analysis because it can have a direct impact on the outcome of vaccination.
We found evidence that only one HPV type was clonally expanded because generally one HPV type, usually a cancer-associated HPV type, had a stronger PCR signal. For example, the HPV16 signal was the strongest signal in 13 (68%) of 19 HSILs and cancers with multiple HPV types including HPV16. Of 49 HSILs and cancers with multiple HPV infections, 24 had other high-risk HPV types, but again there was generally only one strong signal, indicating that one type was predominant. It is unknown if subjects with multiple infections including several cancer-associated HPV types would be protected by a vaccine not including all cancer-associated types.
This study provides further evidence for the role of HPV in cervical carcinogenesis, as demonstrated by high ORs and attributable fractions associated with various pathologic states, particularly the most advanced lesions. The highest ORs were associated with HPV16 and other cancer-associated types. A higher risk of cervical disease was also associated with increasing signal strength in a PCR-based HPV assay, an indirect measure of viral load. This finding may have implications for screening programs, given the importance of properly defining the threshold of HPV detection to maximize sensitivity and specificity of the test (47). The high attributable fractions observed argue that cancer-associated HPV types have a preponderant role in the development of HSILs and cancer, since the attributable fractions for cancer-associated HPV types and for any HPV were almost the same. Thus, we have identified at least 80% of the HPV types responsible for the cervical cancer in this population and, therefore, should be able to formulate a vaccine against the correct combination of HPV types to reach our ultimate goal of controlling this worldwide devastating disease.
| NOTES |
|---|
Supported by Public Health Service (PHS) contracts N01CP21081 and N01CP31061 between the National Cancer Institute (NCI), National Institutes of Health, Department of Health and Human Services, and FUCODOCSA (Costa Rican Foundation for Training in Health Sciences), Caja Costarricense de Seguro Social, Costa Rica. R. D. Burk was supported by PHS grant R01CA78527 from the NCI.
We acknowledge the collaboration of Julie Buckland and Kay Helgesen (IMS, Rockville, MD) for data management and Annie Arslan (International Agency for Research on Cancer, Lyon, France) for statistical analysis and excellent suggestions. We thank Deidra Kelly (The Johns Hopkins University, Baltimore, MD) and Dr. Laurie Mango (Neuromedical Systems, New York, NY) for their collaboration in the interpretation of cytologic specimens and Dr. Nubia Muñoz (International Agency for Research on Cancer) for her critical review of the manuscript and useful comments. Reagents and services were supplied or discounted by CYTYC Inc. (Boxborough, MA), National Testing Laboratories (Fenton, MO), Utah Medical (Midvale), and Neuromedical Systems (Suffern, NY). We offer special recognition for the excellent work of the study staff in Costa Rica, in particular Fernando C|fardenas, Manuel Barrantes, Elmer Pérez (supervisors), and Lidia Ana Morera and Iris Ugarte (nurses). We also acknowledge the collaboration of health authorities in Costa Rica for their enthusiastic support of this project and of the outreach workers of the Ministry of Health of Costa Rica who carried out the population census for their dedication to the health of the people of Guanacaste.
| REFERENCES |
|---|
|
|
|---|
1 Pisani P, Parkin DM, Munoz N, Ferlay J. Cancer and infection: estimates of the attributable fraction in 1995. Cancer Epidemiol Biomarkers Prev 1997;6:387-400.[Abstract]cancerlit;97328233
2 IARC Monographs on the Evaluation of the Carcinogenic Risks to Humans. Vol. 64. Human papillomaviruses. Lyon (France): International Agency for Research on Cancer; 1995.
3 Koutsky L. Epidemiology of genital human papillomavirus infection. Am J Med 1997;102:3-8.[Medline]cancerlit;97360692
4 Melkert PW, Hopman E, van den Brule AJ, Risse EK, van Diest PJ, Bleker OP, et al. Prevalence of HPV in cytomorphologically normal cervical smears, as determined by the polymerase chain reaction, is age-dependent. Int J Cancer 1993;53:919-23.[ISI][Medline]cancerlit;93231692
5 Burk RD, Kelly P, Feldman J, Bromberg J, Vermund SH, Dehovitz JA, et al. Declining prevalence of cervicovaginal human papillomavirus infection with age is independent of other risk factors. Sex Trans Dis 1996;23:333-41.[ISI][Medline]
6 Wright TC, Kurman RJ. A critical review of the morphologic classification systems of preinvasive lesions of the cervix: the scientific basis for shifting the paradigm. Papillomavirus Rep 1994;5:175-82.
7 Hildesheim A, Schiffman MH, Gravitt PE, Glass AG, Greer CE, Zhang T, et al. Persistence of type-specific human papillomavirus infection among cytologically normal women. J Infect Dis 1994;169:235-40.[ISI][Medline]cancerlit;94149304
8 Herrero R, Schiffman MH, Bratti C, Hildesheim A, Balmaceda I, Sherman M, et al. Design and methods of a population-based natural history study of cervical neoplasia in a rural province of Costa Rica: the Guanacaste Project. Rev Panam Salud Publica 1997;1:362-75.[Medline]cancerlit;97323842
9 The 1988 Bethesda System for reporting cervical/vaginal cytologic diagnoses. National Cancer Institute workshop. JAMA 1989;262:931-4.[CrossRef][ISI][Medline]cancerlit;92686453
10 The Bethesda System for reporting cervical/vaginal cytologic diagnoses. Report of the 1991 workshop. Am J Surg Pathol 1992;16:914-6.[CrossRef][ISI][Medline]cancerlit;93036191
11 Schiffman MH, Kiviat NB, Burk RD, Shah KV, Daniel RW, Lewis R, et al. Accuracy and interlaboratory reliability of human papillomavirus DNA testing by hybrid capture. J Clin Microbiol 1995;33:545-50.[Abstract]cancerlit;95270668
12 Tachezy R, Van Ranst MA, Cruz Y, Burk RD. Analysis of short novel human papillomavirus sequences. Biochem Res Commun 1994;204:820-7.cancerlit;95071400
13
Ho GY, Burk RD, Klein S, Kadish AS, Chang CJ, Palan P, et
al. Persistent genital human papillomavirus infection as a risk factor for persistent cervical
dysplasia. J Natl Cancer Inst 1995;87:1365-71.
14 Jiang G, Qu W, Ruan H, Burk RD. Elimination of false positive signals in enhanced chemiluminescence (ECL) detection of amplified HPV DNA from clinical samples. Biotechniques 1995;19:566-8.[ISI][Medline]cancerlit;96113673
15 Qu W, Jiang G, Cruz Y, Chang CJ, Ho GY, Klein RS, et al. PCR detection of human papillomavirus: comparison between MY09/MY11 and GP5+/GP6+ primer systems. J Clin Microbiol 1997;35:1304-10.[Abstract]cancerlit;97305966
16
Bosch FX, Manos MM, Munoz N, Sherman M, Jansen AM,
Peto J, et al. Prevalence of human papillomavirus in cervical cancer: a worldwide perspective. International Biological Study on Cervical Cancer (IBSCC) Study Group. J Natl Cancer
Inst 1995;87:796-802.
17
Schatzkin A, Freedman LS, Schiffman MH, Dawsey SM.
Validation of intermediate end points in cancer research. J Natl Cancer Inst 1990;82:1746-52.
18
Bruzzi P, Green SB, Byar DP, Brinton LA, Schairer C.
Estimating the population attributable risk for multiple risk factors using case-control data. Am J Epidemiol 1985;122:904-14.
19 Horvitz DG, Thompson, DJ. A generalization of sampling without replacement from a finite universe. J Am Stat Assoc 1952;47:663-85.[CrossRef][ISI]
20 Huber PJ. The behavior of maximum likelihood methods under nonstandard conditions. In Le Cam LM, Neyman J, editors. Proceedings of the 5th Berkeley Symposium, vol 1. Berkeley and Los Angeles (CA): Univ California Press; 1967. p. 221-33.
21 White H. Maximum likelihood estimation of misspecified models. Econometrica 1982;50:1-25.[CrossRef][ISI]
22 Sherman ME, Schiffman MH, Herrero R, Kelly D, Bratti C, Mango L, et al. Performance of a semiautomated Papanicolaou smear screening system. Cancer (Cancer Cytopathol) 1998;84:273-80.[CrossRef][ISI][Medline]
23 Hutchinson ML, Zahniser DJ, Sherman ME, Herrero R, Alfaro M, Bratti MC, et al. Utility of liquid-based cytology for cervical cancer screening: results of a population-based study conducted in a high cervical cancer incidence region of Costa Rica. Cancer Cytopathol. 1999;87:48-55.
24 Schneider DL, Herrero R, Bratti C, Greenberg MD, Hildesheim A, Sherman ME, et al. Cervicography screening for cervical cancer among 8460 women in a high-risk population. Am J Obstet Gynecol 1999;180:290-8.[CrossRef][ISI][Medline]cancerlit;99143018
25 Munoz N, Kato I, Bosch FX, Eluf-Neto J, de Sanjose S, Gili M, et al. Risk factors for HPV DNA detection in middle-aged women. Sex Trans Dis 1996;23:504-10.[ISI][Medline]
26 Bosch FX, Munoz N, de San Jose S, Navarro C, Moreo P, Ascunce N, et al. Human papillomavirus and cervical intraepithelial neoplasia grade III/carcinoma in situ: a case-control study in Spain and Colombia. Cancer Epidemiol Biomarkers Prev 1993;2:415-22.[Abstract]cancerlit;94034722
27 Munoz N, Bosch FX, de San Jose S, Tafur L, Izarzugaza I, Gili M, et al. The causal link between human papillomavirus and invasive cervical cancer: a population-based case-control study in Colombia and Spain. Int J Cancer 1992;52:743-9.[ISI][Medline]cancerlit;93052861
28
Palefsky JM, Minkoff H, Kalish LA, Levine A, Sacks HS,
Garcia P, et al. Cervicovaginal human papillomavirus infection in human immunodeficiency
virus-1-positive and high-risk HIV-negative women. J Natl Cancer Inst 1999;91:226-35.
29 Franco EL, Villa LL, Ruiz A, Costa MC. Transmission of cervical human papillomavirus infection by sexual activity: differences between low and high oncogenic risk types. J Infect Dis 1995;172:756-63.[ISI][Medline]cancerlit;95386967
30
Kjær SK, van den Brule AJ, Bock JE, Poll PA, Engholm
G, Sherman ME, et al. Determinants for genital human papillomavirus (HPV) infection in 1000
randomly chosen young Danish women with normal Pap smear: are there different risk profiles
for oncogenic and nononcogenic HPV types? Cancer Epidemiol Biomarkers Prev 1997;6:799-805.
31
Ho GY, Bierman R, Beardsley L, Chang CJ, Burk RD. Natural
history of cervicovaginal papillomavirus infection in young women. N Engl J Med 1998;338:423-8.
32 Chauoki N, Bosch FX, Munoz N, Meijer CJ, El Gueddari B, El Ghazi A, et al. The viral origin of cervical cancer in Rabat, Morocco. Int J Cancer 1998;75:546-54.[CrossRef][ISI][Medline]cancerlit;98126130
33 Ponten J, Adami HO, Bergstrom R, Dillner J, Friberg LG, Gustafsson L, et al. Strategies for global control of cervical cancer. Int J Cancer 1995;60:1-26.[ISI][Medline]cancerlit;95113559
34
Park TW, Richart RM, Sun, XW, Wright TC Jr. Association
between human papillomavirus type and clonal status of cervical squamous intraepithelial
lesions. J Natl Cancer Inst 1996;88:355-8.
35 Torroella-Kouri M, Morsberger S, Carrillo A, Mohar A, Meneses A, Ibarra M, et al. HPV prevalence among Mexican women with neoplastic and normal cervixes. Gynecol Oncol 1998;70:115-20.[CrossRef][ISI][Medline]cancerlit;98375546
36 Matsukura T, Sugase M. Identification of genital human papillomaviruses in cervical biopsy specimens: segregation of specific virus types in specific clinicopathologic lesions. Int J Cancer 1995;61:13-22.[ISI][Medline]cancerlit;95221020
37 Kalantari M, Karlsen F, Johansson B, Sigurjonsson T, Warleby B, Hagmar B. Human papillomavirus findings in relation to cervical intraepithelial neoplasia grade. Human Pathol 1997;28:899-904.[CrossRef][ISI][Medline]
38 Ho GY, Kadish AS, Burk RD, Basu J, Palan PR, Mikhail M, Romney SL. HPV 16 and cigarette smoking as risk factors for high-grade cervical intra-epithelial neoplasia. Int J Cancer 1998;78:281-5.[CrossRef][ISI][Medline]cancerlit;98437948
39 Huang S, Afonina I, Miller BA, Beckman AM. Human papillomavirus types 52 and 58 are prevalent in cervical cancers from Chinese women. Int J Cancer 1997;70:408-11.[CrossRef][ISI][Medline]cancerlit;97185966
40 Lin QQ, Yu SZ, Qu W, Cruz Y, Burk RD. Human papillomavirus types 52 and 58 [letter]. Int J Cancer 1998;75:484-5.[CrossRef][ISI][Medline]cancerlit;98115348
41
Burges RA, Monk BJ, Kurosaki T, Anton-Culver H, Vasilev
SA, Berman ML, et al. Human papillomavirus type 18: association with poor prognosis in early
stage cervical cancer. J Natl Cancer Inst 1996;88:1361-8.
42 Lombard I, Vincent-Salomon A, Validire P, Zafrani B, de la Rochefordiere A, Clough K, et al. Human papillomavirus genotype as a major determinant of the course of cervical cancer. J Clin Oncol 1998;16:2613-9.[Abstract]cancerlit;98368408
43
Viladiu P, Bosch FX, Castelsague X, Munoz N, Escriba JM,
Hamsikova E, et al. Human papillomavirus DNA and antibodies to human papillomaviruses 16
E2, L2, and E7 peptides as predictors of survival in patients with squamous cell cervical cancer. J Clin Oncol 1997;15:610-9.
44 van Ranst MA, Tachezy R, Delius H, Burk RD. Taxonomy of human papillomaviruses. Papillomavirus Rep 1993;4:61-5.
45
Chichareon S, Herrero R, Munoz N, Bosch FX, Jacobs MV,
Deacon J, et al. Risk factors for cervical cancer in Thailand: a case-control study. J Natl
Cancer Inst 1998;90:50-7.
46 Walboomers JM, Jacobs MV, Manos MM, Bosch FX, Kummer JA, Shah KV, et al. Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol 1999;189:12-9.[CrossRef][ISI][Medline]
47
Schiffman M, Herrero R, Hildesheim A, Sherman ME, Bratti
M, Wacholder S, et al. HPV DNA testing for cervical cancer screening: results from the 8,500
randomly selected women in a high-risk province of Costa Rica. JAMA 2000;283:87-93.
Manuscript received June 21, 1999; revised December 10, 1999; accepted December 20, 1999.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
L. K. Hamlin-Douglas, F. Coutlee, M. Roger, E. L. Franco, and P. Brassard Prevalence and Age Distribution of Human Papillomavirus Infection in a Population of Inuit Women in Nunavik, Quebec Cancer Epidemiol. Biomarkers Prev., November 1, 2008; 17(11): 3141 - 3149. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. T. Lindau, M. L. Drum, E. Gaumer, H. Surawska, and J. A. Jordan Prevalence of High-Risk Human Papillomavirus Among Older Women Obstet. Gynecol., November 1, 2008; 112(5): 979 - 989. |






